Skip to main content

Advertisement

Table 4 Primer used for CHART-PCR

From: Truncation of the transcriptional repressor protein Cre1 in Trichoderma reesei Rut-C30 turns it into an activator

Primer name Sequence 5′–3′ References
epiactinTr_f CTTCCCTCCTTTCCTCCCCCTCCAC [17]
epiactinTr_r GCGACAGGTGCACGTACCCTCCATT [17]
episar1Tr_f GTCAGGAAATGCCGCACAAGCAAGA [17]
episar1Tr_r TGTGTTTTACCGCCTTGGCCTTTGG [17]
epixyr1_1Tr_f CCTTTGGCCATCTACACAAGAGCAA [45]
epixyr1_1Tr_r CGCAATTTTTATTGCTGTTCGCTTC [45]
epicbh1_1Tr_f AAGGGAAACCACCGATAGCAGTGTC [46]
epicbh1_1Tr_r TTTCACTTCACCGGAACAAACAAGC [46]
epixn1_1Tr_f GCACTCCAAGGCCTTCTCCTGTACT [46]
epixyn1_1Tr_r TAGATTGAACGCCACCCGCAATATC [46]