Skip to main content

Advertisement

TableĀ 3 Sequences of primers used for RT-qPCR

From: Comparing the physiochemical parameters of three celluloses reveals new insights into substrate suitability for fungal enzyme production

Gene Forward primer Reverse primer
actin (NCU04173) CATCGACAATGGTTCGGGTATGTG CCCATACCGATCATGATACCATGATG
cbt-1/clp-1 (NCU05853) CGCCCTGACCTACACCTAC GGCCAAACGACCAAAGAGC
D-xylulose kinase (NCU11353) GGCACATCATCGCTTCACTG CAAGGGAGATGCGCGAGG
ce16-1 (NCU09416) GGTGCTGCTCCCATCTACTAC GTACTTGGCGATGGCGAC