Skip to main content

Advertisement

Table 2 Primers used in this study

From: Efficient gene editing in Neurospora crassa with CRISPR technology

Primer name Sequence 5′-3′ Used for
β-tubulin-p F TGCGACCAGGTTCAGGAGAGC Genomic PCR (Figure 3e)
actin F GTCCCCGTCATCATGGTATC qRT-PCR (Figure 4)
actin R CTTCTCCATGTCGTCCCAGT qRT-PCR (Figure 4)
clr-2 F GCACCATCAATGTCGATACCTAC qPCR, qRT-PCR (Figures 3b; 4a)
clr-2 R1 CATTGGCCACATGGTTGTTGACC qPCR (Figure 3b, e)
clr-2 R2 CCATCACACCGAATCTTTCGTCT qRT-PCR (Figure 4a)
cbh-1 F CTGCGTTGATGGTGCTGAGTAC qRT-PCR (Figure 4b)
cbh-1 R GAGCTCGAAGCCCTGGTAGG qRT-PCR (Figure 4b)
gh5-1 F CTCCTGCTAGCACCACCACTG qPCR, qRT-PCR (Figures 3b, c; 4c)
gh5-1 R1 CAAGGCGCTCCATGGCGAAG qPCR (Figure 3b, c)
gh5-1 R2 CTGCGGAGAGTCTGGATGGTG qRT-PCR (Figure 4c)
gh6-2 F GCTCTGCCTGGAGCCAGTG qPCR, qRT-PCR (Figures 3c; 4d)
gh6-2 R1 GTGGTGGTAACCTGAGCGCC qPCR (Figure 3c)
gh6-2 R2 CTTGCTGGTGGTGCTAGAG qRT-PCR (Figure 4d)