Table 5 Primers used in this study
Name | Sequence (5′-3′) | Purpose |
|---|---|---|
ade8_f | GAATTGGGTACCGGGCCCCCCCTCGAGGTCGACTGGCCGTTCATAGCGATGTC (sequence upstream of the HindIII-site in pRS426 in italic, sequence upstream of ade8+ in normal letters) | Cloning of ade8+ in pCcAde8 |
ade8_r | GCCGCTCTAGAACTAGTGGATCCCCCGGGCTGAGCTCGTTTCCATCGTCATCA (sequence downstream of the EcoRI-site in pRS426 in italic, sequence downstream of ade8+ in normal letters) | Cloning of ade8+ in pCcAde8 |
Lcc5-fwd | CTCCCATCTACACACAACAAGCTTATCGCCATGTCGTTTGCTTGGAAAGCATTGGC (A. bisporus Pgpd sequence is in italic, lcc5 sequence in normal letters) | Cloning of lcc5 for overexpression in pYSK-lcc5 |
Lcc5-rev | CCACTGGCCCTCTGGTCAACTATAATATTATTTAGGGATACATAGGGAGCAAGTTCGAA (Tlcc1 sequence is in italic, lcc5 sequence in normal letters) | Cloning of lcc5 for overexpression in pYSK-lcc5 |
Lcc9-fwd | CTCCCATCTACACACAACAAGCTTATCGCCATGTCCAGGAAACTTTTCTCTCTCGCC (A. bisporus Pgpd sequence is in italic, lcc9 sequence in normal letters) | Cloning of lcc9 for overexpression in pYSK-lcc9 |
Lcc9-rev | CCACTGGCCCTCTGGTCAACTATAATATTATTTAAGGAGTGGGGACAATTTGGATAGAGGT (Tlcc1 sequence is in italic, lcc9 sequence in normal letters) | Cloning of lcc9 for overexpression in pYSK-lcc9 |
Lcc9-antisense 1-fwd | CTCCCATCTACACACAACAAGCTTATCGCCCGGGATTCTCATAGTTGTAAGTGCTGC (A. bisporus Pgpd sequence is in italic, lcc9 antisense 1 sequence in normal letters) | Cloning of lcc9-antisense fragment 1 in pYSK-lcc9-antisense-1 |
Lcc9- antisense 1-rev | CACTGGCCCTCTGGTCAACTATAATATTATAGATGGGCCTTGGACCTGCCG (Tlcc1 sequence is in italic, lcc9 antisense 1 sequence in normal letters) | Cloning of lcc9-antisense fragment 1 in pYSK-lcc9-antisense-1 |
Lcc9- antisense 2-fwd | CTCCCATCTACACACAACAAGCTTATCGCCCGGACCACTTCCTCCTGGGGCA (A. bisporus Pgpd sequence is in italic, lcc9 antisense 2 sequence in normal letters) | Cloning of lcc9-antisense fragment 2 in pYSK-lcc9-antisense-2 |
Lcc9- antisense 2-rev | CACTGGCCCTCTGGTCAACTATAATATTATCTCTCATGGTCGACGAAATCCAGATC (Tlcc1 sequence is in italic, lcc9 antisense 2 sequence in normal letters) | Cloning of lcc9-antisense fragment 2 in pYSK-lcc9-antisense-2 |
Pgpd-F | GATATCGAAGAAGAATTCAGAGGTCCGCAAGTA (A. bisporus Pgpd sequence, EcoRV site underlined) | Cloning of A. bisporus gpdII promotor for pCRII-hph-lcc9 vector construction |
Pgpd-R | AAGTGGTCCGGGCGATAAGCTTGTTGTGTGTAGATGG (A. bisporus Pgpd sequence is in italic, lcc9 antisense 2 sequence in normal letters) | Cloning of A. bisporus gpdII promotor for pCRII-hph-lcc9 vector construction |
Lcc9-antisense-hphF | GCTTATCGCCCGGACCACTTCCTCCTGGGGCA (A. bisporus Pgpd sequence is in italic, lcc9 antisense 2 sequence in normal letters) | Cloning of lcc9 antisense fragment 2 for pCRII-hph-lcc9 vector construction |
Lcc9-antisense-hphR | TGCTATGACTCTCTCATGGTCGACGAAATCCAGATC (Tlcc9 sequence is in italic, lcc9 antisense 2 sequence in normal letters) | Cloning of lcc9 antisense fragment 2 for pCRII-hph-lcc9 vector construction |
Tlcc9-F | ACCATGAGAGAGTCATAGCACATAGCCATACCGACAC (Tlcc9 sequence is in italic, lcc9 antisense 2 sequence in normal letters) | Cloning of C. cinerea lcc9 terminator for pCRII-hph-lcc9 vector construction |
Tlcc9-R | GGGCCCGTCAAAGGAGTCAGCCCTTGGACATG (Tlcc9 sequence, ApaI site underlined) | Cloning of C. cinerea lcc9 terminator for pCRII-hph-lcc9 vector construction |
DPf | ATGTCGATCCGCATCCTACTCCTC (sequence of ade8 from startcodon onwards) | Diagnosis PCR for nuclear ade8+ insertion |
DPr | ATCCCAGGCGGAGAGATTGCG (sequence of ade8 with its last triplets for amino acids) | Diagnosis PCR for nuclear ade8+ insertion |
PF | ACATCCACCATCTCCGTTTTCTCCCAT (A. bisporus Pgpd sequence) | PCR of OK130 co-transformants of lcc9-antisense-constructs |
PR | TGACTATAGCAGCCTCCTACCACTG (Tlcc1 sequence) | PCR of OK130 co-transformants of lcc9-antisense-constructs |
qRT-lcc9-F | ATGTCCAGGAAACTTTTCTCTCTCG (lcc9 sequence + 1 to + 25) | qRT-PCR of lcc9 |
qRT-lcc9-R | ATGTTCGAGACCGTCATGGTACT (reverse complementary lcc9 sequence of + 79 to + 101) | qRT-PCR of lcc9 |