Skip to main content

Table 5 Primers used in this study

From: Selection markers for transformation of the sequenced reference monokaryon Okayama 7/#130 and homokaryon AmutBmut of Coprinopsis cinerea

Name Sequence (5′-3′) Purpose
ade8_f GAATTGGGTACCGGGCCCCCCCTCGAGGTCGACTGGCCGTTCATAGCGATGTC (sequence upstream of the HindIII-site in pRS426 in italic, sequence upstream of ade8+ in normal letters) Cloning of ade8+ in pCcAde8
ade8_r GCCGCTCTAGAACTAGTGGATCCCCCGGGCTGAGCTCGTTTCCATCGTCATCA (sequence downstream of the EcoRI-site in pRS426 in italic, sequence downstream of ade8+ in normal letters) Cloning of ade8+ in pCcAde8
Lcc5-fwd CTCCCATCTACACACAACAAGCTTATCGCCATGTCGTTTGCTTGGAAAGCATTGGC (A. bisporus Pgpd sequence is in italic, lcc5 sequence in normal letters) Cloning of lcc5 for overexpression in pYSK-lcc5
Lcc5-rev CCACTGGCCCTCTGGTCAACTATAATATTATTTAGGGATACATAGGGAGCAAGTTCGAA (Tlcc1 sequence is in italic, lcc5 sequence in normal letters) Cloning of lcc5 for overexpression in pYSK-lcc5
Lcc9-fwd CTCCCATCTACACACAACAAGCTTATCGCCATGTCCAGGAAACTTTTCTCTCTCGCC (A. bisporus Pgpd sequence is in italic, lcc9 sequence in normal letters) Cloning of lcc9 for overexpression in pYSK-lcc9
Lcc9-rev CCACTGGCCCTCTGGTCAACTATAATATTATTTAAGGAGTGGGGACAATTTGGATAGAGGT (Tlcc1 sequence is in italic, lcc9 sequence in normal letters) Cloning of lcc9 for overexpression in pYSK-lcc9
Lcc9-antisense 1-fwd CTCCCATCTACACACAACAAGCTTATCGCCCGGGATTCTCATAGTTGTAAGTGCTGC (A. bisporus Pgpd sequence is in italic, lcc9 antisense 1 sequence in normal letters) Cloning of lcc9-antisense fragment 1 in pYSK-lcc9-antisense-1
Lcc9- antisense 1-rev CACTGGCCCTCTGGTCAACTATAATATTATAGATGGGCCTTGGACCTGCCG (Tlcc1 sequence is in italic, lcc9 antisense 1 sequence in normal letters) Cloning of lcc9-antisense fragment 1 in pYSK-lcc9-antisense-1
Lcc9- antisense 2-fwd CTCCCATCTACACACAACAAGCTTATCGCCCGGACCACTTCCTCCTGGGGCA (A. bisporus Pgpd sequence is in italic, lcc9 antisense 2 sequence in normal letters) Cloning of lcc9-antisense fragment 2 in pYSK-lcc9-antisense-2
Lcc9- antisense 2-rev CACTGGCCCTCTGGTCAACTATAATATTATCTCTCATGGTCGACGAAATCCAGATC (Tlcc1 sequence is in italic, lcc9 antisense 2 sequence in normal letters) Cloning of lcc9-antisense fragment 2 in pYSK-lcc9-antisense-2
Pgpd-F GATATCGAAGAAGAATTCAGAGGTCCGCAAGTA (A. bisporus Pgpd sequence, EcoRV site underlined) Cloning of A. bisporus gpdII promotor for pCRII-hph-lcc9 vector construction
Pgpd-R AAGTGGTCCGGGCGATAAGCTTGTTGTGTGTAGATGG (A. bisporus Pgpd sequence is in italic, lcc9 antisense 2 sequence in normal letters) Cloning of A. bisporus gpdII promotor for pCRII-hph-lcc9 vector construction
Lcc9-antisense-hphF GCTTATCGCCCGGACCACTTCCTCCTGGGGCA (A. bisporus Pgpd sequence is in italic, lcc9 antisense 2 sequence in normal letters) Cloning of lcc9 antisense fragment 2 for pCRII-hph-lcc9 vector construction
Lcc9-antisense-hphR TGCTATGACTCTCTCATGGTCGACGAAATCCAGATC (Tlcc9 sequence is in italic, lcc9 antisense 2 sequence in normal letters) Cloning of lcc9 antisense fragment 2 for pCRII-hph-lcc9 vector construction
Tlcc9-F ACCATGAGAGAGTCATAGCACATAGCCATACCGACAC (Tlcc9 sequence is in italic, lcc9 antisense 2 sequence in normal letters) Cloning of C. cinerea lcc9 terminator for pCRII-hph-lcc9 vector construction
Tlcc9-R GGGCCCGTCAAAGGAGTCAGCCCTTGGACATG (Tlcc9 sequence, ApaI site underlined) Cloning of C. cinerea lcc9 terminator for pCRII-hph-lcc9 vector construction
DPf ATGTCGATCCGCATCCTACTCCTC (sequence of ade8 from startcodon onwards) Diagnosis PCR for nuclear ade8+ insertion
DPr ATCCCAGGCGGAGAGATTGCG (sequence of ade8 with its last triplets for amino acids) Diagnosis PCR for nuclear ade8+ insertion
PF ACATCCACCATCTCCGTTTTCTCCCAT (A. bisporus Pgpd sequence) PCR of OK130 co-transformants of lcc9-antisense-constructs
PR TGACTATAGCAGCCTCCTACCACTG (Tlcc1 sequence) PCR of OK130 co-transformants of lcc9-antisense-constructs
qRT-lcc9-F ATGTCCAGGAAACTTTTCTCTCTCG (lcc9 sequence + 1 to + 25) qRT-PCR of lcc9
qRT-lcc9-R ATGTTCGAGACCGTCATGGTACT (reverse complementary lcc9 sequence of + 79 to + 101) qRT-PCR of lcc9
\