Skip to main content

Table 1 Yeast strains used in this study

From: Modulating CRISPR gene drive activity through nucleocytoplasmic localization of Cas9 in S. cerevisiae

Strain Genotype References
BY4741 MAT a his3∆1 leu2∆0 met15∆0 ura3∆0 [74]
BY4742 MATα his3∆1 leu2∆0 lys2∆0 ura3∆0 [74]
GFY-3206a BY4742; his3Δ::(u1)::prCDC12::mCherry::NLS SV40 ::SHS1(t)::prCCW12::SpHIS5::MX(t)::(u1)::HIS3(t) [29]
GFY-3207 BY4742; his3Δ::(u1)::prCDC12::mCherry::SHS1(t)::prCCW12::SpHIS5::MX(t)::(u1)::HIS3(t) [29]
GFY-2756b BY4741; his3Δ::(u2)::prGAL::SpCas9::eGFP::NLS SV40 ::ADH1(t)::prMX::Kan R ::MX(t)::(u2)::HIS3(t) [29]
GFY-3470c BY4741; his3Δ::(u2)::prGAL::SpCas9::eGFP::NLS SV40 ::NLS SV40 ::CDC10(t)::prMX::CaURA3::MX(t)::(u2)::HIS3(t) This study
GFY-3465d BY4741; his3Δ::(u2)::prGAL::SpCas9::eGFP::NLS Class2- I ::CDC10(t)::prMX::CaURA3::MX(t)::(u2)::HIS3(t) This study
GFY-3443e BY4741; his3Δ::(u2)::prGAL::SpCas9::eGFP::NLS(P6S) Class2- I ::CDC10(t)::prMX::CaURA3::MX(t)::(u2)::HIS3(t) This study
GFY-3444 BY4741; his3Δ::(u2)::prGAL::SpCas9::eGFP::NLS(R1L) Class2- I ::CDC10(t)::prMX::CaURA3::MX(t)::(u2)::HIS3(t) This study
GFY-3445 BY4741; his3Δ::(u2)::prGAL::SpCas9::eGFP::NLS(P6L) Class2- I ::CDC10(t)::prMX::CaURA3::MX(t)::(u2)::HIS3(t) This study
GFY-3446 BY4741; his3Δ::(u2)::prGAL::SpCas9::eGFP::NLS(R1Q/P6L) Class2- I ::CDC10(t)::prMX::CaURA3::MX(t)::(u2)::HIS3(t) This study
GFY-3447 BY4741; his3Δ::(u2)::prGAL::SpCas9::eGFP::NLS(R1Q/P6S) Class2- I ::CDC10(t)::prMX::CaURA3::MX(t)::(u2)::HIS3(t) This study
GFY-3466d BY4741; his3Δ::(u2)::prGAL::SpCas9::eGFP::NLS Class2- II ::CDC10(t)::prMX::CaURA3::MX(t)::(u2)::HIS3(t) This study
GFY-3449 BY4741; his3Δ::(u2)::prGAL::SpCas9::eGFP::NLS(S9T) Class2- II ::CDC10(t)::prMX::CaURA3::MX(t)::(u2)::HIS3(t) This study
GFY-3450 BY4741; his3Δ::(u2)::prGAL::SpCas9::eGFP::NLS(T8A) Class2- II ::CDC10(t)::prMX::CaURA3::MX(t)::(u2)::HIS3(t) This study
GFY-3451 BY4741; his3Δ::(u2)::prGAL::SpCas9::eGFP::NLS(T8A/S9T) Class2- II ::CDC10(t)::prMX::CaURA3::MX(t)::(u2)::HIS3(t) This study
GFY-3467f BY4741; his3Δ::(u2)::prGAL::SpCas9::eGFP::NLS Class3 ::CDC10(t)::prMX::CaURA3::MX(t)::(u2)::HIS3(t) This study
GFY-3452 BY4741; his3Δ::(u2)::prGAL::SpCas9::eGFP::NLS(K4R) Class3 ::CDC10(t)::prMX::CaURA3::MX(t)::(u2)::HIS3(t) This study
GFY-3454 BY4741; his3Δ::(u2)::prGAL::SpCas9::eGFP::NLS(W7V) Class3 ::CDC10(t)::prMX::CaURA3::MX(t)::(u2)::HIS3(t) This study
GFY-3455 BY4741; his3Δ::(u2)::prGAL::SpCas9::eGFP::NLS(A10V) Class3 ::CDC10(t)::prMX::CaURA3::MX(t)::(u2)::HIS3(t) This study
GFY-3456 BY4741; his3Δ::(u2)::prGAL::SpCas9::eGFP::NLS(F11Y) Class3 ::CDC10(t)::prMX::CaURA3::MX(t)::(u2)::HIS3(t) This study
GFY-3468g BY4741; his3Δ::(u2)::prGAL::SpCas9::eGFP::NES PKI- like ::CDC10(t)::prMX::CaURA3::MX(t)::(u2)::HIS3(t) This study
GFY-3469h BY4741; his3Δ::(u2)::prGAL::SpCas9::eGFP::NES Consensus ::CDC10(t)::prMX::CaURA3::MX(t)::(u2)::HIS3(t) This study
GFY-3471 BY4741; his3Δ::(u2)::prGAL::SpCas9::eGFP::NES PKI- like ::NES PKI- like ::CDC10(t)::prMX::CaURA3::MX(t)::(u2)::HIS3(t) This study
GFY-3472 BY4741; his3Δ::(u2)::prGAL::SpCas9::eGFP::NES PKI- like ::NLS SV40 ::CDC10(t)::prMX::CaURA3::MX(t)::(u2)::HIS3(t) This study
GFY-2758 BY4741; his3Δ::(u2)::prGAL::SpCas9::eGFP:: NLS SV40 ::NES PKI- like ::ADH1(t)::prMX::Kan R ::MX(t)::(u2)::HIS3(t) [29]
GFY-3716i BY4741; his3Δ::(u2)::prGAL::NLS SV40 SpCas9::NLS SV40 ::eGFP::NES PKI- like ::CDC10(t)::prMX::Kan R ::MX(t)::(u2)::HIS3(t) This study
GFY-3717 BY4741; his3Δ::(u2)::prGAL::NLS SV40 SpCas9::NLS SV40 ::eGFP::NES Consensus ::CDC10(t)::prMX::Kan R ::MX(t)::(u2)::HIS3(t) This study
GFY-3435j BY4741; his3Δ::(u2)::prGAL::SpCas9::eGFP::NLS Class2- I ::CDC10(t)::prCCW12::SpHIS5::MX(t)::(u2)::HIS3(t) NUP188::mCherry::ADH1(t)::prMX::CaURA3::MX(t) This study
GFY-3436 BY4741; his3Δ::(u2)::prGAL::SpCas9::eGFP::NLS Class2- II ::CDC10(t)::prCCW12::SpHIS5::MX(t)::(u2)::HIS3(t) NUP188::mCherry::ADH1(t)::prMX::CaURA3::MX(t) This study
GFY-3437 BY4741; his3Δ::(u2)::prGAL::SpCas9::eGFP::NLS Class3 ::CDC10(t)::prCCW12::SpHIS5::MX(t)::(u2)::HIS3(t) NUP188::mCherry::ADH1(t)::prMX::CaURA3::MX(t) This study
GFY-3438 BY4741; his3Δ::(u2)::prGAL::SpCas9::eGFP::NES PKI- like ::CDC10(t)::prCCW12::SpHIS5::MX(t)::(u2)::HIS3(t) NUP188::mCherry::ADH1(t)::prMX::CaURA3::MX(t) This study
GFY-3439 BY4741; his3Δ::(u2)::prGAL::SpCas9::eGFP::NES Consensus ::CDC10(t)::prCCW12::SpHIS5::MX(t)::(u2)::HIS3(t)NUP188::mCherry::ADH1(t)::prMX::CaURA3::MX(t) This study
  1. aThe SV40 nuclear localization signal was SRADPKKKRKV. The artificial (u1) sites have the sequence 5′ ATGACGGTGGACTTCGGCTACGTAGGGCGATT 3′ where the bold is the 20 bp target and the PAM is underlined [51]. SpHIS5 refers to Schizosaccharomyces pombe HIS5 (the functional equivalent of S. cerevisiae HIS3)
  2. bThe (u2) sequence includes 5′ GCTGTTCGTGTGCGCGTCCTGGG 3′ [51]. SpCas9 refers to Streptococcus pyogenes Cas9
  3. cThe cloning strategy to construct GFY-3470 (and also GFY-3443-3447, 3449-3452, 3454-3456, 3465-3469, and 3471-3472) included first creating a parental vector (pGF-IVL1444) using yeast in vivo plasmid assembly [71] containing eGFP-SpeI(site)-CDC10(t)-prCCW12-SpHIS5-MX(t) on pRS315. Second, custom genes were synthesized (Genscript, Piscataway, NJ) containing the 3′ most 180 bp of eGFP, a C-terminal NLS or NES signal, stop codon, and 191 bps of the 3′ UTR of CDC10. Third, substitutions were made to the NLS sequence using a modified PCR mutagenesis protocol [73]. Fourth, the NLS/NES sequence was inserted into pGF-IVL1444 using in vivo assembly. Fifth, the entire construct (from eGFP through the MX terminator) was amplified using a high-fidelity polymerase (KOD Hot-Start, EMD Millipore), digested with DpnI, transformed into a yeast strain harboring an integrated prHIS3-(u2)-prGAL-SpCas9-eGFP-ADH1(t)-prMX-KanR-MX(t)-(u2)-HIS3(t) (GFY-2755), and selected on SD-HIS. Sixth, a second round of integration was used to convert the CDC10(t)-prCCW12-SpHIS5-MX(t) marker to CDC10(t)-prMX-CaURA3-MX(t) using pGF-IVL1412 as a template. Note, for constructs harboring dual signals (e.g. NLSSV40–NLSSV40), two glycine residues were included between the two sequences. Integration of all constructs was confirmed by growth phenotype, diagnostic PCRs, and DNA sequencing
  4. dA previous study identified a number of novel classes of monopartite NLS signals from a random peptide library screen [50]. These were designated as “Class 2” NLS signals with a general structure of RXXKRXR (Class 2-I) or KRXR (Class 2-II) and a full consensus sequence of (P/R)XXKR(ˆED)(K/R) where (^ED) is any residue except Asp or Glu. The full sequences for the sampled NLSs included RAAKRPRTT and APAKRARTS, respectively
  5. eMutations were chosen [50] for each of the classes of identified NLS signals
  6. fThe consensus sequence for Class 3 NLS signals [50] was determined as KRX(W/F/Y)XXAF. The signal used was AAAKRSWSMAF
  7. gThe prototypical NES(PKI-like) signal sequence was slightly modified to yield a NES of LAKILGALDIN [52, 53]
  8. hThe consensus sequence ΦX3ΦX2ΦXΦ where Φ is a hydrophobic residue (L, I, V, M, F, W, C, T, or A) of a Class 1a NES signal as determined previously [52]. The sequence used was LLQQLLLLQIN
  9. iYeast strains GFY-3716 and GFY-3717 were constructed similar to GFY-3470 but were transformed to prHIS3-(u2)-prGAL-NLSSV40SpCas9-NLSSV40-eGFP-ADH1(t)-KanR-(u2)-HIS3(t) yeast (GFY-2759). Following integration of the C-terminal tag along with the SpHIS5 marker, a final switch was performed (using pGF-IVL1412) to include the CDC10(t) sequence along with the KanR marker
  10. jThe mCherry tag was appended to the C-terminus of NUP188 by transforming an amplified fragment of NUP188(CT)-mCherry-ADH1(t)-prMX-CaURA3-MX(t)-NUP188(t) including 500 bp of flanking sequence (DNA from GFY-3347) to create GFY-3435 to 3439
Back to article page

Fungal Biology and Biotechnology

ISSN: 2054-3085

Contact us