Skip to main content


Table 3 Primer used for ChIP-qPCR

From: Truncation of the transcriptional repressor protein Cre1 in Trichoderma reesei Rut-C30 turns it into an activator

Primer name Sequence 5′–3′ Reference
ChIP_xyr1 upstream f TACACAAGAGCAATGGCCCTAGC This study
ChIP_xyr1 upstream r TGGATGGATGGAGAACGGGATG This study