Skip to main content

Table 2 Primer used for qPCR

From: Truncation of the transcriptional repressor protein Cre1 in Trichoderma reesei Rut-C30 turns it into an activator

Primer name Sequence 5′–3′ References
actfw TGAGAGCGGTGGTATCCACG [35]
actrev GGTACCACCAGACATGACAATGTTG [35]
sar1fw TGGATCGTCAACTGGTTCTACGA [35]
sar1rev GCATGTGTAGCAACGTGGTCTTT [35]
xyr1f CCCATTCGGCGGAGGATCAG [35]
xyr1r CGAATTCTATACAATGGGCACATGGG [35]
taqxyn1 f CAGCTATTCGCCTTCCAACAC [13]
taqxyn1 r CCAAAGTTGATGGGAGCAGAA [13]
cbh1f GATGATGACTACGCCAACATGCTG [12]
cbh1r ACGGCACCGGGTGTGG [12]
cre1_a_f ACCTCCTGAATCCAACGTCGG [17]
cre1_a_r TGGGTGCGAATGTGCCTGG [17]
bga1f CGTTTGATCCTTTCGGCGGCT [19]
bga1r CCAAAGGTCATGTATATGTTGAAGATGGTC [19]
gal1f GGAGGCATGGACCAGGC [19]
gal1r GACATGCTTGTTGGAGGTGACG [19]
xorf CTGTGACTATGGCAACGAAAAGGAG [19]
xorr CACAGCTTGGACACGTGAAGAG [19]
st RT 1 CCGTCTACCGTCTGTTGTGC [5]
st RT 2 GAAGTAGGAAAGAACCGCATTG [5]