Skip to main content

Table 1 Primers used for strain construction in this study

From: Truncation of the transcriptional repressor protein Cre1 in Trichoderma reesei Rut-C30 turns it into an activator

Primer name Sequence 5′–3′ References
5′cre1_NotI fwd GCGGCCGCTGGAGGTGACGAGAAGAAAAATTCAGG This study
5′cre1_XmaI rev CCCGGGAGTCAAAAAGCAAGTACGCGACGTTG This study
hph_XmaI_BamHI CCCGGGTTGGATCCAGGGAGACGAGGTTGTGATGAATAC This study
hph_SpeI rev ACTAGTAAGTAGCACCGCTGTCGTCTG This study
5Pcre1_NotI fwd GCGGCCGCAGCCAAGACTCAGCATAAAGAGGTTG This study
5Pcre1_XmaI rev CCCGGGAGGTACCAAACAAAGCGAGCAAGTAC This study
ptef_BspEI fwd TCCGGATGTGTGACAGCTCGCGCAG This study
ptef_NdeI rev CATATGTGACGGTTTGTGTGATGTAGCGTG This study
cre1-96_NdeI fwd CATATGATGCAACGAGCACAGTCTGCC This study
Cre1-96_BamHI rev GGATCCTTAGAAAAAAAAGCAGGTAATGGAGGTGC This study
cre1-96_BspEI fwd TCCGGAATGCAACGAGCACAGTCTGCC This study
cre1-96-TAA_NdeI rev CATATGGAAAAAAAAGCAGGTAATGGAGGTGC This study
linker_NheI rev GCTAGCGCGGGGGGCGCAC This study
linker_NdeI fwd CATATGCACAACATGGTCAAGCAGAAGC This study
YFP_NheI fwd GCTAGCATGGTCAGCAAGGGCGAGG This study
YFP_BamHI rev GGATCCCTTGTACAGCTCGTCCATGCCG This study