Skip to main content

Advertisement

Table 2 Oligonucleotide primers with restriction sites

From: Promoters from the itaconate cluster of Ustilago maydis are induced by nitrogen depletion

Plasmid Primers/specifications Restriction enzymes
pUMa43 P otef -gfp-Tnos; ori ColE1; ampR; U. maydis ip R-locus  
P tad1 -gfp fwd:
CTCGGTACCTTCGACTTGGTGGATACTGCGGCTGTTG
rev:
GTCGGTCTTGACTCGACCCAGCTCACCGGATCCGTA
KpnI/BamHI
P itp1 -gfp fwd:
TCGAAATTCGAGCTCGGTACCGACCTGACAGAAGAGATAG
rev:
AGCTCCTCGCCCTTGCTCACCATGGTTCGACTTGGTGGATACTG
KpnI/NcoI
P adi1 -gfp fwd:
TCGAAATTCGAGCTCGGTACCTCAGCCGATAGGTTTCAC
rev:
AGCTCCTCGCCCTTGCTCACCATGGTGAGCTGGGTCGAGTC
KpnI/NcoI
P mtt1 -gfp fwd:
TCGAAATTCGAGCTCGGTACCGTTTACCGCACGCTGTA
rev:
AGCTCCTCGCCCTTGCTCACCATGGTGGATGACGAATCTCAAG
KpnI/NcoI