Skip to main content
Fig. 2 | Fungal Biology and Biotechnology

Fig. 2

From: A flavoprotein supports cell wall properties in the necrotrophic fungus Alternaria brassicicola

Fig. 2

Generation of Δabmak1 and Δabmak1-c by homologous recombination. a Schematic representation of the AbMak1 locus (grey box) in the wild-type and the replacement construct with the Hyg B resistance cassette (Hph gene) and flanking sequences. b Schematic representation of the AbMak1 locus in the Δabmak1 mutant and the replacement construct with the nourseothricin resistance cassette (Nat gene) and flanking sequences. Arrows indicate the position of primers used for PCR screening of mutants. c Gel electrophoresis of PCR products obtained from template DNA of the wild-type, Δabmak1 or Δabmak1-c strains with the indicated primer pairs. Molecular sizes (kb) were estimated based on a 1 kb ladder (lane L, Eurogentec, Seraing, Belgium). Primer 1: CACAGCAACCTTGAACACGA; primer 2: CATTCCTCAATCTGTCCGCG; primer 3: TGGTCGTTACACCAGGGATC; primer 4: GGCGAAGAATCTCGTGCTTT; primer 5: CATCACAGTTTGCCAGTGATAC; primer 6: GTTGTAAAACGACGGCCAGT; primer 7: GGCTTCGTGGTCATCTCGTA

Back to article page