Skip to main content

Table 3 Primers used in this study

From: Phytochelatin synthase is required for tolerating metal toxicity in a basidiomycete yeast and is a conserved factor involved in metal homeostasis in fungi

Name Sequence (5′-3′) Purpose
AS008 gtaacgccagggttttcccagtcacgacgCTGATTTCTGCGAAGAGG Disruption of Sporobolomyces PCS1
AS002 GGTCTTTCCAGGGAGAGAGGGTTCATTCTGAGTGAG
AS003 CAAGTAGAACGAAGGGTTCGCATTCTCAACCATCTC
AS009 gcggataacaatttcacacaggaaacagcCAAGAGTTGTTCGGTGCG
AS005 GGGGTACCATGACGCTTGCCACCAAAGC Cloning Sporobolomyces PCS1 cDNA
AS006 GCTCTAGACTAGTGACAACCCTTCTGC
ALID0562 TCTCTCCCTGGAAAGACC Amplification of URA5 selectable marker
ALID0564 AACCCTTCGTTCTACTTG
AS012 TCGGTTATCGGTTAAGGC Gene replacement in S. pombe
AS013 GTCGACCTGCAGCGTACGTCCCTCTTGCAATGCTCG
AS014 CGAGCTCGAATTCATCGATTCCCAAAGGCGTTCTAG
AS015 TAAACGAAAGCACGAGCG
KanMX F CGTACGCTGCAGGTCGAC
KanMX R ATCGATGAATTCGAGCTCG
AS016 GCCCATATGACGCTTGCCACCAAAGC Sporobolomyces PCS1 for expression in S. pombe
AS017 GCCCATATGCTAGTGACAACCCTTCTG
AS018 CGGCATATGAACATTGTTAAACGAG Amplifcation of S. pombe PCS1
AS019 ATTGGATCCTCACGTATTTTTACAGCAG
ALID2091 CAAGCTGCTGTAAAAATACGATGGTGAGCAAGGGCGAG GFP localization of S. pombe Pcs1
ALID2092 CTCGCCCTTGCTCACCATCGTATTTTTACAGCAGCTTG
AISV066 CCGGGATCCTTACTTGTACAGCTCGTC
AS004 CAAGAGTTGTTCGGTGCG Wild type Sporobolomyces PCS1 for complementation
AS020 GGTCTTTCCAGGGAGAGACTGATTTCTGCGAAG
ALID1432 GAGTACATGGTCTACATG GPD1 for northern blots
ALID1433 AAGGCAATGTGGCAGAGG
  1. Letters in italics are restriction enzyme cut sites introduced into the DNA sequences. Lower case letters indicate regions that were included for possible use for in vivo recombination into S. cerevisiae plasmids.